Head hair as a sensory organ

It's no mystery that hair acts to amplify the sense of touch. Everyone is familiar with the feeling of a bug crawling on their arm, and everyone who has ever gone swimming with a beard knows how much more pleasurable (like a million tiny hands gently pulling at your chin) it is than swimming without a beard. There are also more mystical ideas about long hair granting a kind of sixth sense.

I recently gave myself a buzz cut after letting my hair grow for about 2 years. My hair is moderately curly, so when it's long it poofs out an inch or two from my scalp. From my experience, I don't think long hair grants any kind of mysterious powers (nor do I think it has any effect on personality or intelligence, although people with certain personality traits may be more likely to choose to grow their hair long), but I was surprised to find that scalp hair does seem to contribute to spatial awareness. My evidence for this (which is admittedly circumstantial and has a low sample size, but this would be a very hard thing to test in a controlled environment, you can't very well have a "double blind" haircut) is that in the 24 hours after I cut my hair, I bonked my head into the wall twice. Once I was leaning over to put something in the trash can, and hit my head on the corner of the doorway that the can is next to. The other time I was in the shower and leaning around the too-hot stream of water to adjust the knobs. So I think scalp hair can function for people kind of like how whiskers function for cats.

I think that when I had poofy hair, I subconsciously used it to provide spatial information about the environment immediately around my head. Lacking that information, but not yet having had a chance to compensate by other means, my lack of hair temporarily increased my propensity to bonk into things.

maximum blastx tblastn translation length?

Blastx the sequence below against SwissProt. It has an orf that's 493 amino acids long, but the best hsp it turns up (from a protein that is completely identical to the orf) is 453 a.a. long. The same is true when you do tblastn the other way. However, when you first translate the orf (for instance here) and Blastp against SwissProt, you get an hsp covering the whole orf. What's going on here? Does Blast have a maximum length it stores translations at? Hopefully someday I'll have time to investigate this further, or maybe some knowledgeable stranger will pass by this blog and let me know. (edit: This seems to be a freak occurrence with this particular sequence. I have since noticed other Blastx searches to find longer hsps than this one. There is a truncated version of this protein in the NCBI Protein database so maybe that has something to do with it)

GCTGAAAAAAAGTGTAACGTCTCTAGCGGGACGGAGGTAGTATTTATTAAGTTCTGGCGT
GAGAAATAGGAATAAATCTGGACCACCGATCTTAGTTAGATCTATGGTTGATATTTATTT
AAGCATAGTTACAAGATACAATATGCATGATTTTATTTAAGCATTGATTTTACATTAAAA
AGCACAATCGTATAATAAGCATAATATAATGCGTATTTAAGCATGACTTTGTATAGTTTT
AAACATTATTCAAATTTTCTCACGTGAAGATTTATTTACACACGAACCCTTCCCTTCCGT
GTGTATATGTATATAAATATTTAATCAAGATTGACGTGGAGTAGCAAGCACAAGCAAAGG
AGACTTCTTATGGACTACAAATCCAGGAGCTTCAGTCATGTCCAAATCCTCCGCTCTATC
TCCATTACCCAATCTGAAATCGAACTCGTTTACCAGCTTGGATAGTGCAAGCTCGTATAA
AGCCATCGCAAACGTGGATCCGGGGCACCCTCTTCGACCCGACCCGAACGGAAGCATCTC
AAAATGCAACCCTTTATAGTCTATGCTCGTCTCGAGGAACCTTTCTGGACGAAATTCTTC
GGGATTTTCCCACAACGAGGGGTCTCTCGATATGGCCCAGTTGTTGACCAACACGACCGT
GCCACGTGGGATGTCGTAGCCGAGCATATTGGCGTCTTGAGTCAATTCTCGAGGGAGCAG
AATTGCGAAAGGTGGATGTAGGCGTAGAATCTCCTTGGATACTGCTTTCAGATATGGCAT
CTTGTCCACGTCATCCTCGGTAATCCCACCTTTGTTTCTAGAAACTTCTCGCACCTCGTT
CTGCAAAGTTTTTAGGGTACGCGGGTTTTTTATGAGCTCCGCCATCGTCCACTCTAGAGC
CGCGAAAGTCGTATCGGTTCCGGCAGAAACCATGTCGAAGATTAGAGCTTTGATTACGTC
ATCCTCGACGGGGTCAGTATCTTTACTCTCTCTCTGAAACTGAAGCAATGTGTCTACGAA
ATTCGTTTCATCATCACCCACCTTCTTCCTTCTATATTTTCGAAGAATACCCTCCATTGA
TCCATCCAACTTTGTACCGACTTTTTCCACTTCTGCATCGACGCCATTTATCCGGTTGAT
CCAAGACAGCCATGGAACGTAATCCCCCACGTTGAAACTTCCCAAGAGCTTGATAACCTT
GATCAGAATCCGATTAAAATCATCTCCGCCGTCGCCCTTCCTCCCTAACACCGCCCTGTG
AATTACGCCGTTCGTCAGCGCCATGAACATCTCGCTCAAGTTCACGACCGTCGTCGGCTT
CGATCGCCTGATCTTCTCAATCATAGCCGACGTTTCCTCTTCTCGAATCCCGCCGAACGA
CTGGACCCTCTTAGCGCTGAGCAGCTGCAGCATGCACATGCTCCGCGCGTTGCGCCAGTG
CTCGCCGTAGGGGGCGAAGGCCACGCCCTTGCCGCTGTACATCAGCCTGTCGAAGATGCT
CAGCCTCGGCCTGCTCGCGAAGATCACGTCTTGGTTCTTCATGATCTCACGCGCCGCCGC
CGCTGAGGAGGCCACTAGGACAGGAGCGCTGCCGAAATGGAGTAGCATCACCTCGCCGTA
GCGCTTGGATAAGGAGGTGAAGGAGCGGTGGGAGAGGGCTCCGATCAGGTGGAAATGGCC
GATCACCGGAAGCCTTAATGGAGACGGCGGCGGCCTCTTTCTTGAGGAAAGACTGGACTT
TCGTTTATGGAAAAGGACCGCCAGTAAGATTAAAGAGACAGAGAAAAATACTAGAAGAGC
GGCCATTTTCTCTTCAGTTGAATATAATGATGGACAAGTTCTTGGAGAAGG

Milling lupins with a pasta maker machine

In an earlier post, I hypothesized that soaked lupin beans could be effectively dehulled with a pasta maker. Turns out, one of my co-workers has a pasta machine, so I finally got the chance to test this hypothesis. And it does in fact work, particularly after the beans have sprouted a little bit.

As is, the pasta machine is an improvement over hand de-hulling, but I think it could be improved. Set to maximum, the gap on this pasta machine is 2.5 mm, I'd like to try one with a 5 mm gap because this one kind of crushed the beans (although, I still think they'd make decent tempe in this state). The rollers are not grippy enough, (this would be less of a problem with wider spacing), you have to apply gentle pressure to the beans to get them to go through. The pasta machine lacks a hopper so beans have to be fed through fairly slowly and can't be piled up very high on the machine, if there were a hopper, the pressure of beans on other beans might be enough to make extra grip on the rollers unnecessary.

I don't think I'll actually end up using this method, because I suspect that dicing with a food processor will turn out to be cheaper and more effective, but it's certainly a viable strategy, and much preferable to hand hulling.

Exporting diagrams from Dia into Microsoft Word or Powerpoint

Short answer: on Windows, export to "emf" format, then add the image to the document like you would any other image.

Lupin tempe and fried lupin hulls

Lupin tempe is highly touted, and apparently one of the most promising possibilities for expanding the presence of lupins in the human food supply. Tempe (or "tempeh", if you prefer the crude anglicization) is made by growing fungus, usually Rhizopus oligosporus (sometimes also with Rhizopus orzae and other minor components) on beans (usually soy beans, but a wide range of substrates are possible). Tempe is a traditional food in Indonesia and is recently becoming popular in Europe and North America. I've made soybean tempe several times and it's turned out well, so I was excited to try to make lupin tempe. Differences between soy and lupin that may make the process different are that lupins are tougher (more fiber, less oil) than soy beans and have a much thicker hull.

A poem in the style of Cid Corman

Although I've only read Livingdying, and a few scattered poems on the Internet, I really enjoy the poetry of Cid Corman (also see here, here, and perhaps even here). Here's a poem I wrote in an attempt to imitate his style:

lupin sprouts

Sprouting lupins is not much different from sprouting any other kind of bean. In this post, I'll relate the sprouting method I used for Australian sweet lupins (which I purchased from Lupina), and highlight some differences I noticed between sprouting lupins and sprouting mung beans. Lupin sprouts are bigger and a bit tougher than mung sprouts, and their cotyledons are much more prominent. The sprouts don't have a strong flavor, but the cotyledons seem to have a faint cucumber taste to them. Any thing you can do with mung sprouts, I think you can do also with lupin sprouts. I made a salad from fresh sprouts, which was good. I also cooked some of them and put them in a stew, which was also good (although you can't really taste them in the stew...).

1. Sort seeds to pick out rocks and remove any obviously damaged seeds.
2. Soak seeds. 1-3 days. For most beans, 12 hours is sufficient. After 12 hours, more than half of the lupin beans will be nicely swelled, but a pretty good portion will still not be. The longer you soak for, the more beans will be swelled and ready to sprout. 3 days seemed to be long enough for 95% or more of the lupin beans to become swelled (I plan to look at this more scientifically in the future). I don't think over-soaking will effect germination rate, but it might be a good idea to change the water and let them breathe for a little while every day. Also, if you happen to have a wire mesh with about 0.6 cm between the wires, it should be easy to screen the unswelled beans from the swelled beans.
3. After soaking, drain and put in a pot, or a large bowl, or any other large container with a cover. Put the cover on (I usually leave it open just a crack, the idea is to keep the humidity high, but you also don't want to suffocate them).
4. Rinse and drain at least once every day. You need to be gentle with lupin sprouts, blasting them with water (as I do with mung sprouts) will cause the cotyledons to snap off which will prevent the sprout from growing any bigger (the cotyledons are what gives them the energy to grow).
5. Do this for about 7 days, or until they are the desired size. At 7 days, some of them will have started making their first little leafs.
6. Rinse, drain, eat, or refrigerate
7. Do not attempt to remove the hulls. Sometimes with other beans, I remove the hulls by soaking the beans in a big pot of water and using my hands to agitate them so the hulls fall off, then just pouring the hulls off. Lupin hulls seem to be attached more firmly than the hulls of other beans. It's definitely possible to slip them off, but the only way I could find to get them off without also knocking the cotyledons off was to individually pull them off of each sprout. That was way more work than I was interested in doing, so I just left them on. The hulls are a bit chewy, which maybe some people won't like, but, it's good fiber, so you might as well just eat them...